In this module:

The Genetic Code

mRNA is the "blueprint" that directs how amino acids are linked together to form proteins in a process called translation . The information is carried in the sequence of nucleotides. For example, the sequence of an mRNA molecule might be:

AUGGAACGUAGAUUUGAGUAG

How does the sequence of mRNA correspond to a protein's primary sequence? In work conducted between 1961 and 1966 by Marshall Nirenberg, H. Gobind Khorana and others, the genetic code was deciphered. Groups of three nucleotides (codons) code for one amino acid. For example, ACG codes for the amino acid threonine. Three nucleotides are read at a time, each coding for one amino acid, until a stop signal is reached.

Click on each codon below to see which amino acid is coded for. Click on the mouse at left to clear the protein sequence.

Click on the blueprint icon at left to see the complete genetic code.

Several codons need special explanation. First, in addition to coding for methionine, AUG signals the start of a protein. All mRNA molecules have AUG somewhere near their beginning to signal the start of protein synthesis. Second, UAA, UAG, and UGA signal for the stop of protein synthesis. AUG is called a start signal, while UAA, UAG, and UGA are called stop signals.

In nearly every lifeform, from viruses to bacteria to plants and animals, the genetic code is the same. Only minor changes have occurred in several billion years of life on earth.